Another type of mutation involves either the insertion or deletion of one or more (some number that is not a multiple of three) nucleotides into a DNA sequence. This type of mutation is known as a frameshift mutation. For an illustration of how devastating this type of mutation can be if it occurs in the coding region of a gene, delete the w from the sentence below.

The cow jumped over the moon.
becomes
The coj umpedo vert hem oon.

The insertion of nucleotides in multiples of three, if not corrected during the "proofreading" of messenger RNA, will cause the insertion of an extra amino acid for each three additional nucleotides. Trinucleotide repeats are sequences of three nucleotides that repeat in tandem and vary in the the number of repeats. Trinucleotide repeat mutations are known to cause at least eight genetic disorders affecting the nervous or neuromuscular system.

You can read more about repeating nucleotide patterns in the section about Y chromosome DNA testing for genealogy.

YAP, an alu insertion

One insertion particularly useful in population studies is the YAP, which stands for "Y chromosome alu polymorphism." Alu is a sequence of approximately 300 base pairs which has inserted itself into a particular region of the DNA. There have been some half a million alu insertions in human DNA; YAP is one of the more recent.

Unstable indels and SNPs are relatively rare.

Only about five percent of human DNA is actually thought to code for traits. Most of the rest is made of long stretches of nucleotide base pairs whose function is not known. Within these stretches are short, moderately repetitive base pair sequences. The number of repeats is inherited and is easily detectable making them ideal identifying markers. The number of repeating units can occasionally change during evolution and descent. Though these changes are rare, they happen frequently enough to make them useful markers for familial relationships.

There are two types of these repetitive sequences. VNTRs (variable number tandem repeats) are repeated sequences that typically range from 10 to 80 bps. These occur fairly frequently in the human genome but there are relatively few different types among the human population.

Short Tandem Repeat (STR) sequences (sometimes called microsatellites) are much shorter (2-10 bps) and may be repeated as many as 100 times at a given location on a chromosome. The human genome contains hundreds of thousands of these STRs evenly distributed on all the chromosomes. STRs represent ideal markers for genetic typing for genealogy because of their rich diversity (polymorphism) and wide distribution. As a further advantage, they are technically somewhat easier to characterize than VNTRs.

Here is a simplified example. Humans have two sets of 23 chromosomes--one set from their mother and one set from their father. So, for example, an individual, Thelma, might inherit a chromosome #17 marker with a short sequence of four bps repeated eight times from her mother, Ethel, and the same sequence repeated three times from her father, Art.

To illustrate :
Maternal chromosome #17 GATCGATCGATCGATCGATCGATCGATCGATC
Paternal chromosome #17 GATCGATCGATC

In real life, more than one STR must be analyzed to establish a person's identity. An STR marker from DNA found at the scene of a crime may match one marker of a suspect. However there will most likely be thousands of unrelated people with the same pattern for that one marker. Increasing the number of markers examined increases the chances of an accurate identification. Matches on three selected STRs gives more than a 2000 to 1 probability that the DNA samples are from the same person. Using nine STRs gives more than a 1 billion to 1 probability.

In 1997, the FBI announced the selection of 13 STR markers to be used in forensic investigations. If any two samples of DNA obtained from different sources (say a crime scene and a suspect) have matching numbers of repeats at all 13 markers, it is virtually certain they are from the same person. Conversely, and as important, if the markers do not match, it can be said with complete confidence that the samples are from two different individuals.

The markers in this set are the CODIS markers (an acronym for Combined DNA Index System)